Chhetri AcademyGCSE & A level Paper Builder

4.6.2.4Genetic engineering

AQA GCSE Combined Science (8464), Higher tier · Biology › Inheritance, variation and evolution › Variation and evolution

Practise Genetic engineering. 14 exam-style questions plus unlimited generated ones on this subtopic, at up to four difficulty levels, with full mark schemes and a progress tracker. Free, no account needed.

Build a paper on this topic

▶ Watch videos on Genetic engineering (Free Science Lessons Combined on YouTube) · Practise all of Variation and evolution

Free downloads:Open in the Notes section

Revision notes

Genetic engineering modifies an organism's genome by introducing a gene from another organism to give a desired characteristic, for example bacteria that make human insulin and GM crops. Everyone needs the uses, benefits, risks and objections; Higher tier students must also describe the main steps.

Grade by grade

What you need to be able to do, from the first marks up to the top grade.

  1. 4
    Define genetic engineeringModifying an organism's genome by introducing a gene from another organism to give a desired characteristic.
  2. 4
    Give examples of genetic engineeringBacteria that make human insulin; crops resistant to disease, insects or herbicides; bigger, better fruits.
  3. 5
    State what GM crops areCrops whose genes have been modified by genetic engineering; they generally give increased yields.
  4. 6
    Give benefits and concerns of GM cropsHigher yields, against concerns about wild flowers, insects and effects on human health.
  5. 7
    Describe the main steps of genetic engineeringEnzymes isolate the gene, it is inserted into a vector, and the vector puts the gene into the required cells.
  6. 8
    Evaluate genetic engineering in agriculture and medicineWeigh the benefits against the risks and objections to reach a justified conclusion.

Notes

What genetic engineering is

  • Genetic engineering is modifying the genome of an organism by introducing a gene from another organism to give a desired characteristic.
  • Bacterial cells have been genetically engineered to produce useful substances such as human insulin to treat diabetes.
  • Plant crops have been genetically engineered to be resistant to diseases or to produce bigger, better fruits.
  • Crops that have had their genes modified in this way are called genetically modified (GM) crops. They include crops resistant to insect attack or to herbicides. GM crops generally show increased yields.
  • Medical research is exploring the possibility of genetic modification to overcome some inherited disorders.

Benefits, risks and objections

  • Benefits: bigger yields from the same land; less of the crop lost to pests or disease; medicines such as insulin made in large amounts; possible future treatments for inherited disorders.
  • Concerns about GM crops include their effect on populations of wild flowers and insects.
  • Some people feel the effects of eating GM crops on human health have not been fully explored.
  • Other objections: genes could spread from GM crops to wild plants (e.g. producing herbicide-resistant weeds), and some people think it is wrong to change an organism's genes.

The main steps grade 7+

  • Enzymes are used to isolate (cut out) the required gene.
  • The gene is inserted into a vector, usually a bacterial plasmid or a virus.
  • The vector is used to insert the gene into the required cells.
  • Genes are transferred to the cells of animals, plants or microorganisms at an early stage in their development, so that they develop with the desired characteristics.
  • For insulin: the human insulin gene is inserted into a plasmid, the plasmid is put into a bacterium, and the bacteria multiply and produce human insulin.

Cheatsheet

  • Genetic engineering = introducing a gene from another organism to give a desired characteristic
  • Bacteria engineered to make human insulin (to treat diabetes)
  • GM crops: resistant to insects, herbicides or disease; bigger fruits; increased yields
  • Concerns: effects on wild flowers and insects; effects of eating GM crops on health not fully explored
  • Steps: enzymes isolate the gene → gene inserted into a vector (plasmid or virus) → vector inserts the gene into the required cells grade 7+
  • Genes are transferred at an early stage of development grade 7+

How to answer each type of question

Give a benefit and a concern of GM crops

2 to 4 marks6
  1. Benefits: resistance to insects, herbicides or disease; increased yields; bigger, better fruit.
  2. Concerns: effects on wild flowers and insects; effects on human health not fully explored.
  3. Link each point to its consequence.

Example. Some crops have been genetically modified to be resistant to insect attack.
Give one advantage and one disadvantage of growing this crop. [2 marks]

Show the model answer
Advantage: less of the crop is damaged by insects, so the yield increases (1). Disadvantage: it may reduce populations of insects (and the animals that feed on them) / the effects on human health of eating it have not been fully explored (1).

Describe the steps of genetic engineering

3 to 4 marks7
  1. Enzymes cut out (isolate) the gene.
  2. The gene is inserted into a vector (plasmid or virus).
  3. The vector carries the gene into the required cells.
  4. Say what happens next, e.g. the bacteria multiply and make the product.

Example. Describe how bacteria can be genetically engineered to produce human insulin. [4 marks]

Show the model answer
Enzymes are used to isolate / cut out the human insulin gene (1). The gene is inserted into a vector, a bacterial plasmid (1). The plasmid is put into a bacterial cell (1). The bacteria multiply and make human insulin (1).

Evaluate a use of genetic engineering

4 to 6 marks8
  1. Use the information provided.
  2. Give the benefits.
  3. Give the risks and objections.
  4. Finish with a justified conclusion.

Example. Scientists have produced a variety of rice that is genetically engineered to contain a substance the body uses to make vitamin A. In some countries many children lack vitamin A, which can cause blindness.
Evaluate the use of this genetically engineered rice. [6 marks]

Show the model answer
Marked by levels; a top answer covers both sides and reaches a conclusion. For example:
It could prevent vitamin A deficiency and blindness in children (1). Rice is eaten every day by many people in these countries, so it would reach many children (1). It may be cheaper than giving vitamin supplements (1). However, genes could spread from the GM rice to wild plants (1). Some people feel the effects of eating GM crops on human health have not been fully explored (1). Some people object to changing an organism's genes (1). Conclusion: the benefit of preventing blindness is large, so growing the rice is probably justified as long as its safety continues to be tested.

Shortcuts and memory tricks

  • Steps as 'cut, paste, deliver': enzymes cut out the gene, it is pasted into a vector, and the vector delivers it into the cell.
  • Vector = vehicle: a plasmid or a virus that carries the gene in.
  • GM crop concerns: wild flowers, insects, human health.

Where marks are lost

  • Confusing genetic engineering with selective breeding or cloning.
  • Saying the vector is an enzyme. Enzymes cut out the gene; the vector (plasmid or virus) carries it.
  • Saying the gene is added to an adult organism. It is transferred at an early stage of development.
  • Giving vague objections such as 'it's unnatural' without explaining a possible effect (on wild flowers, insects or health).

Exam technique

  • Use the key words: isolate, enzymes, vector, plasmid, virus.
  • In 'evaluate' questions, give both sides and a conclusion supported by the information given.
  • Say that the gene comes 'from another organism'.

Quick recall

Cover the answers and test yourself. The app has these as flashcards that come back just before you'd forget them.

Bacteria have been genetically engineered to produce a substance used to treat diabetes.
Name this substance.
(Human) insulin
The plasmid is described as a vector.
What is meant by a vector in genetic engineering? Give one other type of vector.
Something used to carry the gene into the required cells; a virus
Medical research is exploring the use of genetic modification to overcome some inherited disorders. In one treatment being researched for cystic fibrosis, a harmless virus is used to carry a normal copy of the gene into cells lining the lungs. Why is the virus described as a vector?
It carries the gene into the cells
The main steps in genetically engineering a crop plant to be resistant to insects are given below, but they are in the wrong order.
A   The vector carries the gene into the cells of the crop plant.
B   Plants grown from the modified cells produce the insect-resistance protein.
C   The gene for insect resistance is identified and cut out of the DNA of the donor organism using enzymes.
D   The gene is inserted into a vector, such as a plasmid.
Write the letters in the correct order.
C, D, A, B

Sample questions

Written for this site in the style of AQA exam questions. They are not taken from real past papers.

Question 1Easy5 marks
Genetic engineering is used in agriculture and in medicine.
(a) What is genetic engineering?
Tick (✓) one box.[1]
  • Breeding organisms with desired characteristics over many generations
  • Growing new plants from small groups of cells
  • Modifying the genome of an organism by introducing a gene from another organism
  • Producing identical copies of an adult animal
(b) Bacteria have been genetically engineered to produce a substance used to treat diabetes.
Name this substance.[1]
(c) Which two characteristics have crop plants been genetically engineered to have?
Tick (✓) two boxes.[2]
  • Ability to grow without light
  • Ability to grow without water
  • Resistance to herbicides
  • Resistance to insect attack
  • Ability to make their own mineral ions
(d) What name is given to crops whose genes have been modified by genetic engineering?[1]
Show the answer and mark scheme
(a) Answer: Modifying the genome of an organism by introducing a gene from another organism
(b) Answer: (Human) insulin
  • (human) insulin
(c) Answer: Resistance to herbicides; Resistance to insect attack
(d) Answer: Genetically modified (GM) crops
  • genetically modified / GM (crops)
Question 2Medium7 marks
Bacteria can be genetically engineered to produce human insulin. The human insulin gene is cut out of human DNA and inserted into a plasmid, which is then put into a bacterial cell.
(a) What is used to cut the insulin gene out of human DNA?
Tick (✓) one box.[1]
  • Antibiotics
  • Antibodies
  • Enzymes
  • Hormones
(b) The plasmid is described as a vector.
What is meant by a vector in genetic engineering? Give one other type of vector.[2]
(c) The plasmid is cut open with the same enzyme that cut out the insulin gene. This leaves short single-stranded sections of DNA, called 'sticky ends', on the plasmid and on the gene.
Explain why the insulin gene can then join into the plasmid.[2]
(d) Suggest two advantages of producing human insulin using genetically engineered bacteria.[2]
Show the answer and mark scheme
(a) Answer: Enzymes
(b) Answer: Something used to carry the gene into the required cells; a virus
  • it carries / inserts the gene into the (required) cell
  • virus
(c) Answer: The unpaired bases on the sticky ends of the gene and of the plasmid are complementary, so they pair up (A with T and C with G) and the gene joins into the plasmid
  • the sticky ends of the gene and the plasmid have complementary / matching (unpaired) bases
  • so the bases pair up (A with T, C with G) / the sticky ends join together
(d) Answer: Large amounts can be made quickly and cheaply because bacteria reproduce rapidly; the insulin is identical to human insulin; no animals need to be used
  • bacteria reproduce quickly so large amounts can be made
  • cheaper / reliable supply
  • the insulin is identical to human insulin (so fewer side effects)
  • no animals are needed / avoids ethical or religious objections to animal insulin
Question 3Hard7 marks
A restriction enzyme called EcoRI cuts DNA wherever it finds the base sequence GAATTC. It cuts between the G and the first A, leaving single-stranded 'sticky ends'.
(a) One strand of a short, straight piece of DNA has this base sequence:
TTGAATTCCGATCGGAATTCAAGCT
How many pieces would this DNA be cut into by EcoRI? Give the number of bases in each piece of this strand.[3]
(b) A gene that was cut out with EcoRI is inserted into a plasmid that has also been cut open with EcoRI.
Explain why using the same enzyme for both allows the gene to join into the plasmid.[2]
(c) When plants or animals are genetically engineered, the gene is transferred to their cells at a very early stage of development.
Explain why.[2]
Show the answer and mark scheme
(a) Answer: 3 pieces: 3 bases, 12 bases and 10 bases
  • EcoRI cuts at two sites, giving 3 pieces
  • the first piece has 3 bases (TTG)
  • the other pieces have 12 bases (AATTCCGATCGG) and 10 bases (AATTCAAGCT)
(b) Answer: Both are cut at the same base sequence, so the sticky ends on the gene and on the plasmid have complementary unpaired bases; these bases pair up, joining the gene into the plasmid
  • both are cut at the same (GAATTC) sequence, so the sticky ends of the gene and the plasmid have complementary / matching unpaired bases
  • so the unpaired bases (on the sticky ends) pair up, joining the gene into the plasmid
(c) Answer: All the cells of the organism are then produced from the modified cell by mitosis, so they all contain the gene and the organism develops with the desired characteristic
  • all the organism's cells develop from the modified cell(s) by mitosis / so every cell contains the gene
  • so the organism develops with the desired characteristic

Related subtopics

Stuck? Get 1-to-1 help. Chhetri Academy tutors GCSE and A level Maths and Science online, with a free 30-minute trial lesson.

Book a free trial