AQA GCSE Biology (8461), Higher tier · Inheritance, variation and evolution › Variation and evolution
Practise Genetic engineering. 14 exam-style questions plus unlimited generated ones on this subtopic, at up to four difficulty levels, with full mark schemes and a progress tracker. Free, no account needed.
Cover the answers and test yourself. The app has these as flashcards that come back just before you'd forget them.
Bacteria have been genetically engineered to produce a substance used to treat diabetes. Name this substance.
(Human) insulin
The plasmid is described as a vector. What is meant by a vector in genetic engineering? Give one other type of vector.
Something used to carry the gene into the required cells; a virus
Medical research is exploring the use of genetic modification to overcome some inherited disorders. In one treatment being researched for cystic fibrosis, a harmless virus is used to carry a normal copy of the gene into cells lining the lungs. Why is the virus described as a vector?
It carries the gene into the cells
The main steps in genetically engineering a crop plant to be resistant to insects are given below, but they are in the wrong order. A The vector carries the gene into the cells of the crop plant. B Plants grown from the modified cells produce the insect-resistance protein. C The gene for insect resistance is identified and cut out of the DNA of the donor organism using enzymes. D The gene is inserted into a vector, such as a plasmid. Write the letters in the correct order.
C, D, A, B
Sample questions
Written for this site in the style of AQA exam questions. They are not taken from real past papers.
Question 1Easy5 marks
Genetic engineering is used in agriculture and in medicine.
(a) What is genetic engineering? Tick (✓) one box.[1]
Breeding organisms with desired characteristics over many generations
Growing new plants from small groups of cells
Modifying the genome of an organism by introducing a gene from another organism
Producing identical copies of an adult animal
(b) Bacteria have been genetically engineered to produce a substance used to treat diabetes. Name this substance.[1]
(c) Which two characteristics have crop plants been genetically engineered to have? Tick (✓) two boxes.[2]
Ability to grow without light
Ability to grow without water
Resistance to herbicides
Resistance to insect attack
Ability to make their own mineral ions
(d) What name is given to crops whose genes have been modified by genetic engineering?[1]
Show the answer and mark scheme
(a)Answer: Modifying the genome of an organism by introducing a gene from another organism
(b)Answer: (Human) insulin
(human) insulin
(c)Answer: Resistance to herbicides; Resistance to insect attack
(d)Answer: Genetically modified (GM) crops
genetically modified / GM (crops)
Question 2Medium7 marks
Bacteria can be genetically engineered to produce human insulin. The human insulin gene is cut out of human DNA and inserted into a plasmid, which is then put into a bacterial cell.
(a) What is used to cut the insulin gene out of human DNA? Tick (✓) one box.[1]
Antibiotics
Antibodies
Enzymes
Hormones
(b) The plasmid is described as a vector. What is meant by a vector in genetic engineering? Give one other type of vector.[2]
(c) The plasmid is cut open with the same enzyme that cut out the insulin gene. This leaves short single-stranded sections of DNA, called 'sticky ends', on the plasmid and on the gene. Explain why the insulin gene can then join into the plasmid.[2]
(d) Suggest two advantages of producing human insulin using genetically engineered bacteria.[2]
Show the answer and mark scheme
(a)Answer: Enzymes
(b)Answer: Something used to carry the gene into the required cells; a virus
it carries / inserts the gene into the (required) cell
virus
(c)Answer: The unpaired bases on the sticky ends of the gene and of the plasmid are complementary, so they pair up (A with T and C with G) and the gene joins into the plasmid
the sticky ends of the gene and the plasmid have complementary / matching (unpaired) bases
so the bases pair up (A with T, C with G) / the sticky ends join together
(d)Answer: Large amounts can be made quickly and cheaply because bacteria reproduce rapidly; the insulin is identical to human insulin; no animals need to be used
bacteria reproduce quickly so large amounts can be made
cheaper / reliable supply
the insulin is identical to human insulin (so fewer side effects)
no animals are needed / avoids ethical or religious objections to animal insulin
Question 3Hard7 marks
A restriction enzyme called EcoRI cuts DNA wherever it finds the base sequence GAATTC. It cuts between the G and the first A, leaving single-stranded 'sticky ends'.
(a) One strand of a short, straight piece of DNA has this base sequence: TTGAATTCCGATCGGAATTCAAGCT How many pieces would this DNA be cut into by EcoRI? Give the number of bases in each piece of this strand.[3]
(b) A gene that was cut out with EcoRI is inserted into a plasmid that has also been cut open with EcoRI. Explain why using the same enzyme for both allows the gene to join into the plasmid.[2]
(c) When plants or animals are genetically engineered, the gene is transferred to their cells at a very early stage of development. Explain why.[2]
Show the answer and mark scheme
(a)Answer: 3 pieces: 3 bases, 12 bases and 10 bases
EcoRI cuts at two sites, giving 3 pieces
the first piece has 3 bases (TTG)
the other pieces have 12 bases (AATTCCGATCGG) and 10 bases (AATTCAAGCT)
(b)Answer: Both are cut at the same base sequence, so the sticky ends on the gene and on the plasmid have complementary unpaired bases; these bases pair up, joining the gene into the plasmid
both are cut at the same (GAATTC) sequence, so the sticky ends of the gene and the plasmid have complementary / matching unpaired bases
so the unpaired bases (on the sticky ends) pair up, joining the gene into the plasmid
(c)Answer: All the cells of the organism are then produced from the modified cell by mitosis, so they all contain the gene and the organism develops with the desired characteristic
all the organism's cells develop from the modified cell(s) by mitosis / so every cell contains the gene
so the organism develops with the desired characteristic